FIV-based MicroRNA Precursor Clone Collection

Benefits and Features

  • Express microRNA precursor transcripts in their native sequence context to ensure interaction with endogenous processing machinery leading to authentic mature microRNAs.

  • Lentivirus-based expression system ensures efficient expression of microRNA in wide range of cell lines including nondividing or difficult-to-transfect cell lines.

  • Replication incompetent FIV-based lentiviral expression system is biologically safe.

  • Monitor transduced cells with co-expressed copGFP fluorescent marker. Select cells stably expressing microRNA construct with Zeocin selection marker.

NEW: Lenti-miRs™: SBI's Next Generation HIV-based MicroRNA Precursor Clone Collection

 

End-User Applications

  • Study of microRNA functions through over-expression of microRNAs in cells. (Shin, 2006; Stegmeier, 2005)

  • Express microRNA in primary cells, stem cells, and non-dividing cells with the lentiviral delivery system. (Mathijs, 2006)

  • Generate cell lines stably expressing microRNA to study celluar pathways and identify of target genes regulated by microRNA.

  • Array format enables MicroRNA screening to be performed in 96-well plates utilizing established protocols.

References
Kit Components
User Manual
Ordering Information
Related Products

 

What is unique about SBI’s microRNA Precursor Clone Collection?
 
First microRNA Precursor Collection in Lentiviral Vector Available for Your Research

MicroRNAs are gaining interest in the research community as elements to fine-tune genetic expression. There are expected to be about 1,000 MicroRNAs encoded in the human genome and they function by either blocking translation of, or degrading, mRNA species corresponding to specific genes. While the number of verified human miRNAs is expanding, there is an increasing need for effective functional testing. System Biosciences (SBI) is offering an arrayed collection of MicroRNA precursors in lentiviral vectors that can be used to modulate the expression of the cognate MicroRNAs in vivo, and thereby study MicroRNA function. The MicroRNA construct are offered as single construct, or as an arrayed collection in plate format. Furthermore, since the constructs are offered in a lentiviral vector backbone, they could be packaged into Lentiviral particles and thereby delivered to primary cells, stem cells, or other hard-to-transfect cell lines.

System Biosciences (SBI) is the only commercially-available collection of MicroRNAs that are cloned in Lentiviral vectors capable of being propagated. The advantage of SBI’s constructs is that they can be stably expressed in a wide variety of cell types, as opposed to synthetic MicroRNAs that can only be transiently expressed in cells. Moreover, the inserts in the SBI’s microRNA Precursor Collection represent more than just the mature microRNA sequences listed in Sanger’s miRBase (http://microrna.sanger.ac.uk/sequences/). Each construct in SBI’s collection consists of the stem loop structure and 100-200 base pairs of upstream and downstream flanking genomic sequence (Fig. 1). This unique feature ensures that the microRNAs expressed from SBI’s constructs would be correctly processed in the cell into mature microRNA.
 

Panel 1:

AAAGGTGGTGGTAAGAGGGTGATTTCTGAATCTTGTAAATACATGGTTTTAGGAGCGGATTCAGATAACCAA
GCATTTAAAATACTATTAATGAAATACAGGAAATGAAACCACAGCATAGATTATGCATGTAGCCAAAATG
TTCAGTTAAACTTCATTTTCAACGTAAGTGAATGAAAATGGTCTAATACTATTTTTCTTATCACTCACACA
GGAAACCAGGATTACCGAGGAGGAAAAAAAGCCTTCCTGTGGTGCTCAACTGTGATTCCTTTTCACCATTC
ACCCTGGATGTTCTCTTCACTGTGGGATGAGGTAGTAGGTTGTATAGTTttagggtcacacccaccactgg
gagatAACTATACAATCTACTGTCTTTCCTAACGTGATAGAAAAGTCTGCATCCAGGCGGTCTGATAGAAA
GTCAGTTAACTAATTGTACAATATTTAAGATTAACTTGTCTTAAAGAGATGTAGTGCAGCATTTGTTTATG
GCCTGGAAATAAATTAATTTAGAGATAAAGTCTGTAGCAAGTACACTGGATGGGGGTGGGGAAACCTTTTG
CTTCTTGTCTTAT
 

Panel 2:


Fig.1 Sample sequence from one of SBI’s microRNA precursor constructs (let-7a-1). The top sequences (Panel 1) indicate the complete insert sequence. The underlined sequences form stem structure and the sequences with Italian lower case form loop structure. The resulting stem-loop structure is shown below the sequence (Panel 2).
 


Details of the Lentiviral Delivery System:

  • Express native microRNAs in target cells through transfection (plasmid form) or transduction (packaged constructs).

  • Simple packaging into pseudoviral particles with SBI’s pPACK Lentivector Packaging System (see: http://www.systembio.com/pPACK.htm)

  • Deliver microRNA expression constructs into wide range of cell lines including non-dividing or difficult-to-transfect cell lines with biologically-safe FIV-based lentivector.

  • RNA polymerase II driven primary microRNA expression offers high level of expression from single copy of insert.

  • Polycistronic expression cassette includes copGFP fluorescent reporter and Zeocin resistance marker on the same transcript as the miRNA to enable tracking and selecting cells expressing the miRNA.

     

Fig 2. Map of MicroRNA precursor construct

 

Fig 3. Efficient Processing of MicroRNA Precursors into Mature MicroRNA Species

SBI's microRNA precursors could be efficiently processed into mature microRNAs which knock down target sequences in transfected cells.  Alkaline phosphatase reporter plasmid with target sequences for mir-143 or mir-196a-1 was co-transfected into 293 cells with pMIF-miRNA construct expressing mir-143, -196-a, or pMIF vector without miRNA(NC).  72 hours after transfection, alkaline phosphatase activity was determined and normalized to that of cells transfected with NC.


References

miRNA discovery

Lee RC, Feinbaum RL, Ambros V. “The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14”. Cell, 75:843-854, 1993.

Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvits HR, Ruvkun G. “The 21-nucleotides let-7 RNA regulates developmental timing in Caenorhabditis elegans”. Nature, 403:901-906, 2000.

Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. “Identification of novel genes coding for small expressed RNAs”. Science, 294:853-858, 2001.

microRNA targets prediction

Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP. “Prediction of plant microRNA targets”. Cell, 110:513-520, 2002.

Lewis BP, Burge CB, Bartel DP. “Conserved seed pairing, often flanking by adenosines, indicates that thousands of human genes are microRNA targets”. Cell, 120:15-20, 2005.

John, B., C. Sander and D. S. Marks (2006). "Prediction of human microRNA targets." Methods Mol Biol, 342: 101-13.

Vector-based miRNA expression

Mathijs Voorhoeve, P., C.L. Sage, M. Schrier, A.J.M.Gillis, H. Stoop, R.Nagel, Y. Liu, J.V.Duijse, J. Drost, A. Griekspoor, E. Zlotorynski, N. Yabuta, G. D.Vita, H. Nojima, L.H.J.Looijenga, and R. Agami (2006). “A Genetic Screen Implicates miRNA-372 and miRNA-373 As Oncogenes in Testicular Germ Cell Tumors.” Cell, 124, 1169-1181

Shin, K. J., E. A. Wall, J. R. Zavzavadjian, L. A. Santat, J. Liu, J. I. Hwang, R. Rebres, T. Roach, W. Seaman, M. I. Simon and I. D. Fraser (2006). "A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression." PNAS U S A, 103(37): 13759-64.

Stegmeier, F., G. Hu, R. J. Rickles, G. J. Hannon and S. J. Elledge (2005). "A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells." PNAS U S A, 102(37): 13212-7.

Primary miRNA processing

Han J, Lee Y, Yeom KH, Kim YK, Jin H, Kim VN. “The Drosha-DGCR8 complex in primary micorRNA processing”. Gene Develop, 18: 3016-3027, 2004.

Han J, Lee Y, Yeom KH, Nam JW, Heo I, Rhee JK, Sohn SY, Cho Y, Zhang BT, Kim VN. “Molecular basis for the recognision of primary microRNAs by the Drosha-DGCR8 complex”. Cell, 125: 887-901.2006.

Zeng Y, Yi R, Cullen BR. “Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha”. EMBO J, 24:138-148, 2005.

Zeng Y, Cullen BR. “Efficient processing of primary microRNA hairpins by Drosha requires flanking nonstructured RNA sequences”. J Bio Chem, 280:27595-27603, 2005.


miRNA functional study

Bennasser, Y., S. Y. Le, M. L. Yeung and K. T. Jeang (2004). "HIV-1 encoded candidate micro-RNAs and their cellular targets." Retrovirology, 1(1): 43.

Esau C, Kang X, Peralta E, Hanson E, Marcusson EG, Ravichandran LV, Sun Y, Koo S, Perera RJ, Jain R, Dean NM, Freier SM, Bennett CF, Lollo B, Griffey R. MicroRNA-143 regulates adipocyte differentiation.
J Biol Chem. 2004 Dec 10;279(50):52361-5.

Hariharan, M., V. Scaria, B. Pillai and S. K. Brahmachari (2005). "Targets for human encoded microRNAs in HIV genes." Biochem Biophys Res Commun, 337(4): 1214-8.

Johnson, S. M., H. Grosshans, J. Shingara, M. Byrom, R. Jarvis, A. Cheng, E. Labourier, K. L. Reinert, D. Brown and F. J. Slack (2005). "RAS is regulated by the let-7 microRNA family." Cell, 120(5): 635-47.

Kim, V. N. (2005). "Small RNAs: classification, biogenesis, and function." Mol Cells, 19(1): 1-15.

Lee, R. C., R. L. Feinbaum and V. Ambros (1993). "The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14." Cell, 75(5): 843-54.

Lee, Y., K. Jeon, J. T. Lee, S. Kim and V. N. Kim (2002). "MicroRNA maturation: stepwise processing and subcellular localization." Embo J, 21(17): 4663-70.

Olsen, P. H. and V. Ambros (1999). "The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation." Dev Biol, 216(2): 671-80.

Pfeffer, S., M. Zavolan, F. A. Grasser, M. Chien, J. J. Russo, J. Ju, B. John, A. J. Enright, D. Marks, C. Sander and T. Tuschl (2004). "Identification of virus-encoded microRNAs." Science, 304(5671): 734-6.

Yi, R., Y. Qin, I. G. Macara and B. R. Cullen (2003). "Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs." Genes Dev, 17(24): 3011-6.
 


Kit Components

Each kit contains 10 μg of endotoxin-free plasmid DNA in TE buffer.

Each kit comes with user manual

 

User Manual
Ordering Information

 

Mature microRNA ID Accession # Vector Catalog # Price
pMIF-cGFP-Zeo (- control) ----- pMIF-cGFP-Zeo MIFCZ300PA-1 $350
hsa-let-7a-1 MI0000060 pMIF-cGFP-Zeo MIFCZ301PA-1 $450
hsa-let-7a-2 MI0000061 pMIF-cGFP-Zeo MIFCZ302PA-1 $450
hsa-let-7c MI0000064 pMIF-cGFP-Zeo MIFCZ303PA-1 $450
hsa-let-7d MI0000065 pMIF-cGFP-Zeo MIFCZ304PA-1 $450
hsa-let-7f-1 MI0000067 pMIF-cGFP-Zeo MIFCZ305PA-1 $450
hsa-let-7f-2 MI0000068 pMIF-cGFP-Zeo MIFCZ306PA-1 $450
hsa-mir-7-3 MI0000265 pMIF-cGFP-Zeo MIFCZ336PA-1 $450
hsa-mir-10a MI0000266 pMIF-cGFP-Zeo MIFCZ337PA-1 $450
hsa-mir-10b MI0000267 pMIF-cGFP-Zeo MIFCZ338PA-1 $450
hsa-mir-21 MI0000077 pMIF-cGFP-Zeo MIFCZ307PA-1 $450
hsa-mir-26a-1 MI0000083 pMIF-cGFP-Zeo MIFCZ308PA-1 $450
hsa-mir-28 MI0000086 pMIF-cGFP-Zeo MIFCZ309PA-1 $450
hsa-mir-29a MI0000087 pMIF-cGFP-Zeo MIFCZ310PA-1 $450
hsa-mir-29b-1 MI0000105 pMIF-cGFP-Zeo MIFCZ320PA-1 $450
hsa-mir-29b-2 MI0000107 pMIF-cGFP-Zeo MIFCZ321PA-1 $450
hsa-mir-30a MI0000088 pMIF-cGFP-Zeo MIFCZ311PA-1 $450
hsa-mir-30c-2 MI0000254 pMIF-cGFP-Zeo MIFCZ333PA-1 $450
hsa-mir-30d MI0000255 pMIF-cGFP-Zeo MIFCZ334PA-1 $450
hsa-mir-31 MI0000089 pMIF-cGFP-Zeo MIFCZ312PA-1 $450
hsa-mir-32 MI0000090 pMIF-cGFP-Zeo MIFCZ313PA-1 $450
hsa-mir-33 MI0000091 pMIF-cGFP-Zeo MIFCZ314PA-1 $450
hsa-mir-34a MI0000268 pMIF-cGFP-Zeo MIFCZ339PA-1 $450
hsa-mir-95 MI0000097 pMIF-cGFP-Zeo MIFCZ315PA-1 $450
hsa-mir-98 MI0000100 pMIF-cGFP-Zeo MIFCZ316PA-1 $450
hsa-mir-99a MI0000101 pMIF-cGFP-Zeo MIFCZ317PA-1 $450
hsa-mir-100 MI0000102 pMIF-cGFP-Zeo MIFCZ318PA-1 $450
hsa-mir-101-1 MI0000103 pMIF-cGFP-Zeo MIFCZ319PA-1 $450
hsa-mir-103-2 MI0000108 pMIF-cGFP-Zeo MIFCZ322PA-1 $450
hsa-mir-103-1 MI0000109 pMIF-cGFP-Zeo MIFCZ323PA-1 $450
hsa-mir-105-1 MI0000111 pMIF-cGFP-Zeo MIFCZ324PA-1 $450
hsa-mir-105-2 MI0000112 pMIF-cGFP-Zeo MIFCZ325PA-1 $450
hsa-mir-107 MI0000114 pMIF-cGFP-Zeo MIFCZ326PA-1 $450
hsa-mir-124a MI0000445 pMIF-cGFP-Zeo MIFCZ342PA-1 $450
hsa-mir-143 MI0000459 pMIF-cGFP-Zeo MIFCZ341PA-1 $450
hsa-mir-147 MI0000262 pMIF-cGFP-Zeo MIFCZ335PA-1 $450
hsa-mir-148a MI0000253 pMIF-cGFP-Zeo MIFCZ332PA-1 $450
hsa-mir-181a-2